ID: 902584807_902584811

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902584807 902584811
Species Human (GRCh38) Human (GRCh38)
Location 1:17432240-17432262 1:17432258-17432280
Sequence CCTAGCTTCCCCTGGTTATCTGC TCTGCCCTTCTTTGTTTAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193} {0: 1, 1: 0, 2: 1, 3: 16, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!