ID: 902594335_902594343

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 902594335 902594343
Species Human (GRCh38) Human (GRCh38)
Location 1:17498047-17498069 1:17498079-17498101
Sequence CCACAGCACCCAGCCTAATGACT CTGGATAGATACCCAGTAGTGGG
Strand - +
Off-target summary No data {0: 48, 1: 878, 2: 1969, 3: 4517, 4: 26018}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!