ID: 902594335_902594344

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 902594335 902594344
Species Human (GRCh38) Human (GRCh38)
Location 1:17498047-17498069 1:17498087-17498109
Sequence CCACAGCACCCAGCCTAATGACT ATACCCAGTAGTGGGATTGCTGG
Strand - +
Off-target summary No data {0: 1417, 1: 9343, 2: 26302, 3: 15708, 4: 10794}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!