ID: 902594338_902594342

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902594338 902594342
Species Human (GRCh38) Human (GRCh38)
Location 1:17498060-17498082 1:17498078-17498100
Sequence CCTAATGACTACTTTCCCTCTGG TCTGGATAGATACCCAGTAGTGG
Strand - +
Off-target summary No data {0: 52, 1: 914, 2: 2055, 3: 4806, 4: 26838}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!