ID: 902611416_902611421

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 902611416 902611421
Species Human (GRCh38) Human (GRCh38)
Location 1:17599715-17599737 1:17599728-17599750
Sequence CCCAGGACCAAATGTGCTGCCTT GTGCTGCCTTCCTTGCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167} {0: 1, 1: 0, 2: 4, 3: 40, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!