ID: 902618464_902618471

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 902618464 902618471
Species Human (GRCh38) Human (GRCh38)
Location 1:17636822-17636844 1:17636872-17636894
Sequence CCTGGGGCTTCATAAGACCTCAG AGTCCAAATTCCTAGCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 168} {0: 1, 1: 0, 2: 0, 3: 19, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!