ID: 902622543_902622550

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902622543 902622550
Species Human (GRCh38) Human (GRCh38)
Location 1:17658944-17658966 1:17658962-17658984
Sequence CCCAGAGGCAGGAGAATGCTTGA CTTGATTTGGTGGGGGAACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 353} {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!