ID: 902624042_902624048

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 902624042 902624048
Species Human (GRCh38) Human (GRCh38)
Location 1:17666639-17666661 1:17666677-17666699
Sequence CCTTTCTCCCCCAAGAACAGCTG CAGACTCCCTTCCCAGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 294} {0: 1, 1: 0, 2: 9, 3: 139, 4: 768}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!