ID: 902626620_902626634

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 902626620 902626634
Species Human (GRCh38) Human (GRCh38)
Location 1:17680243-17680265 1:17680296-17680318
Sequence CCAGCATCCTGCTGTTTCCTCAG CAGCGAGCCTTCCGGCCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 394} {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!