ID: 902642378_902642384

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 902642378 902642384
Species Human (GRCh38) Human (GRCh38)
Location 1:17775138-17775160 1:17775165-17775187
Sequence CCTGATGCTCTCTAAATACAGGT AGGCTGAGGCCAGATGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123} {0: 1, 1: 1, 2: 6, 3: 74, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!