ID: 902649315_902649326

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 902649315 902649326
Species Human (GRCh38) Human (GRCh38)
Location 1:17826331-17826353 1:17826380-17826402
Sequence CCCGGGTTCACAAAGCGCCTGTT CCTCCACCAAGGCCACAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78} {0: 1, 1: 0, 2: 1, 3: 27, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!