ID: 902673764_902673771

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 902673764 902673771
Species Human (GRCh38) Human (GRCh38)
Location 1:17994148-17994170 1:17994191-17994213
Sequence CCTCATTGTACATTCACAAACAC GGGCCTGGTGACCGAGATGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!