ID: 902692379_902692385

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 902692379 902692385
Species Human (GRCh38) Human (GRCh38)
Location 1:18117981-18118003 1:18117995-18118017
Sequence CCACCACCTGAAGAGCCTGGCAT GCCTGGCATGGGGAAGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 186} {0: 1, 1: 0, 2: 2, 3: 45, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!