ID: 902697517_902697525

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 902697517 902697525
Species Human (GRCh38) Human (GRCh38)
Location 1:18150315-18150337 1:18150344-18150366
Sequence CCTCTCTGGAAAATGGGGATAGC CTTACGGAGGCTGGGAGGATTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 104, 4: 704} {0: 1, 1: 0, 2: 1, 3: 16, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!