ID: 902718108_902718123

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 902718108 902718123
Species Human (GRCh38) Human (GRCh38)
Location 1:18286635-18286657 1:18286686-18286708
Sequence CCCGCCTGGGCCAGGCTACTCTT CAGGCACAGCAGGCTGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 256} {0: 1, 1: 0, 2: 4, 3: 45, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!