ID: 902719295_902719305

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 902719295 902719305
Species Human (GRCh38) Human (GRCh38)
Location 1:18293375-18293397 1:18293422-18293444
Sequence CCAGGCATCCTCCTCTGCCTGCT TGCTCCCCAGGCGGCCCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 748} {0: 1, 1: 0, 2: 0, 3: 16, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!