ID: 902724244_902724256

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 902724244 902724256
Species Human (GRCh38) Human (GRCh38)
Location 1:18324444-18324466 1:18324491-18324513
Sequence CCTGCAGGGGGCGGTCATGAGCC ATCACCTGGTCCAGGTGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 164} {0: 1, 1: 0, 2: 1, 3: 10, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!