ID: 902747006_902747017

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 902747006 902747017
Species Human (GRCh38) Human (GRCh38)
Location 1:18481111-18481133 1:18481150-18481172
Sequence CCAGCCCAGCGGTGGGGTGGGAA AAGGAGGAAGCAGAGGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211} {0: 1, 1: 1, 2: 7, 3: 102, 4: 708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!