ID: 902756460_902756463

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 902756460 902756463
Species Human (GRCh38) Human (GRCh38)
Location 1:18552481-18552503 1:18552497-18552519
Sequence CCAACTCACTGAAAGCCAGTCTC CAGTCTCTCCACCTGGACCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 38, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!