ID: 902769326_902769333

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 902769326 902769333
Species Human (GRCh38) Human (GRCh38)
Location 1:18636625-18636647 1:18636655-18636677
Sequence CCCGGGAGAGCCCGGCTGCGGGG CCTGGTCTACCCCAATACTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 408} {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!