ID: 902779027_902779037

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 902779027 902779037
Species Human (GRCh38) Human (GRCh38)
Location 1:18692802-18692824 1:18692839-18692861
Sequence CCCTCCATGGCCTCAATATATGG GAAGAGCAAGAGCCTCCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102} {0: 1, 1: 0, 2: 0, 3: 23, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!