ID: 902782466_902782472

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 902782466 902782472
Species Human (GRCh38) Human (GRCh38)
Location 1:18713272-18713294 1:18713305-18713327
Sequence CCACACACCACTGTTGTCAGGGA CAGTAGGACCACAGGCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 159} {0: 1, 1: 0, 2: 2, 3: 24, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!