ID: 902794595_902794609

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 902794595 902794609
Species Human (GRCh38) Human (GRCh38)
Location 1:18793060-18793082 1:18793107-18793129
Sequence CCCCAGGAGTAGCTTACATCACC AGCTCTGTTGCCTAGATGCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!