ID: 902816176_902816185

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 902816176 902816185
Species Human (GRCh38) Human (GRCh38)
Location 1:18917996-18918018 1:18918011-18918033
Sequence CCCAGTTCTGGCACCCAGAGGAA CAGAGGAAGGGGCAGGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 263} {0: 1, 1: 1, 2: 11, 3: 135, 4: 1191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!