ID: 902819986_902819993

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 902819986 902819993
Species Human (GRCh38) Human (GRCh38)
Location 1:18937888-18937910 1:18937927-18937949
Sequence CCAGCTATGCAAAAGAACCGGCA TCTCAACTCCAACCCAGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50} {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!