ID: 902819987_902819993

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 902819987 902819993
Species Human (GRCh38) Human (GRCh38)
Location 1:18937905-18937927 1:18937927-18937949
Sequence CCGGCACCAGCACAGCCTCTCTT TCTCAACTCCAACCCAGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 404} {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!