ID: 902820067_902820082

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 902820067 902820082
Species Human (GRCh38) Human (GRCh38)
Location 1:18938323-18938345 1:18938365-18938387
Sequence CCCACCTCCAGCTGCTGGGAAGG GAGGGCTGCTACAGCGTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 467} {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!