ID: 902820729_902820740

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 902820729 902820740
Species Human (GRCh38) Human (GRCh38)
Location 1:18941738-18941760 1:18941786-18941808
Sequence CCTACCTCATAGTGAGACCTCAG GCTTCCAAATCCACACAACGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 204} {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!