ID: 902839112_902839120

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 902839112 902839120
Species Human (GRCh38) Human (GRCh38)
Location 1:19064295-19064317 1:19064333-19064355
Sequence CCTGGGCCAGCCTTTTTCTCAGC TTTCCTAGAAAGGGCCAAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!