ID: 902841154_902841162

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 902841154 902841162
Species Human (GRCh38) Human (GRCh38)
Location 1:19074741-19074763 1:19074767-19074789
Sequence CCCGCGGAGGGAACTTAATGCAC GAGGGAGAACAGAGGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30} {0: 1, 1: 0, 2: 9, 3: 148, 4: 1322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!