ID: 902856492_902856498

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 902856492 902856498
Species Human (GRCh38) Human (GRCh38)
Location 1:19210092-19210114 1:19210122-19210144
Sequence CCAGCTGCGGCAACTCCTTCATC CGGAGTAGGACGCGGACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 154} {0: 1, 1: 0, 2: 0, 3: 7, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!