ID: 902866907_902866916

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 902866907 902866916
Species Human (GRCh38) Human (GRCh38)
Location 1:19285752-19285774 1:19285788-19285810
Sequence CCTGGGAGCCATCTGCAGGCTTT GCTGCTATGCAGAGGGCACAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 24, 4: 204} {0: 1, 1: 1, 2: 3, 3: 34, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!