ID: 902872334_902872342

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 902872334 902872342
Species Human (GRCh38) Human (GRCh38)
Location 1:19322120-19322142 1:19322145-19322167
Sequence CCACCTTGGAGGCTGTGGAAGCC CAGCAAGCATCAGTGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 268} {0: 1, 1: 0, 2: 7, 3: 56, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!