ID: 902873474_902873483

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 902873474 902873483
Species Human (GRCh38) Human (GRCh38)
Location 1:19327548-19327570 1:19327584-19327606
Sequence CCTCCCTCCATCTGTTCACCCAG CTGTGTGCCAGGCACCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 55, 4: 497} {0: 1, 1: 3, 2: 25, 3: 196, 4: 957}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!