ID: 902888425_902888431

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 902888425 902888431
Species Human (GRCh38) Human (GRCh38)
Location 1:19423808-19423830 1:19423836-19423858
Sequence CCTCCAAGTAGCTGGGGGGCCAC CTGGCTAATTTTTTGTAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 366} {0: 2, 1: 60, 2: 118, 3: 288, 4: 970}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!