ID: 902890229_902890238

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 902890229 902890238
Species Human (GRCh38) Human (GRCh38)
Location 1:19438022-19438044 1:19438072-19438094
Sequence CCAGTAGTGCCCCAGACGAGGAA TCCCACTACCTCCTACGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57} {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!