ID: 902890231_902890242

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 902890231 902890242
Species Human (GRCh38) Human (GRCh38)
Location 1:19438032-19438054 1:19438076-19438098
Sequence CCCAGACGAGGAATCCATCCATC ACTACCTCCTACGTCAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94} {0: 1, 1: 0, 2: 1, 3: 9, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!