ID: 902890234_902890247

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 902890234 902890247
Species Human (GRCh38) Human (GRCh38)
Location 1:19438050-19438072 1:19438083-19438105
Sequence CCATCCAAGTATTGTTCTTACCT CCTACGTCAGGGGAGGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 161} {0: 1, 1: 0, 2: 2, 3: 29, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!