ID: 902892847_902892855

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 902892847 902892855
Species Human (GRCh38) Human (GRCh38)
Location 1:19457045-19457067 1:19457096-19457118
Sequence CCCAGAAAGGCAGGAAGTTCCAG TGTTGGAACTAAAGCACAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 270} {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!