ID: 902896709_902896718

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 902896709 902896718
Species Human (GRCh38) Human (GRCh38)
Location 1:19484941-19484963 1:19484954-19484976
Sequence CCAGCCTGAGGCCATGGAGAAGG ATGGAGAAGGCAAAGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 340} {0: 1, 1: 0, 2: 8, 3: 126, 4: 1167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!