ID: 902925098_902925102

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 902925098 902925102
Species Human (GRCh38) Human (GRCh38)
Location 1:19690736-19690758 1:19690773-19690795
Sequence CCTACAACTCTGGCTATGACTCC CAGTTTCCCAATCTATGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139} {0: 1, 1: 0, 2: 1, 3: 46, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!