ID: 902925099_902925104

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902925099 902925104
Species Human (GRCh38) Human (GRCh38)
Location 1:19690757-19690779 1:19690775-19690797
Sequence CCATGCTCCCAAGTCTCAGTTTC GTTTCCCAATCTATGATCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 333} {0: 1, 1: 0, 2: 1, 3: 49, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!