ID: 902925854_902925862

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 902925854 902925862
Species Human (GRCh38) Human (GRCh38)
Location 1:19695258-19695280 1:19695297-19695319
Sequence CCCTCTGCTGCCCATTGCTTCAG CTACAGAGGACATGGTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 267} {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!