ID: 902931732_902931749

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 902931732 902931749
Species Human (GRCh38) Human (GRCh38)
Location 1:19736309-19736331 1:19736347-19736369
Sequence CCCACCCCCCTGATTCAATTACC CCCATGACCCATGTGGATTGTGG
Strand - +
Off-target summary {0: 4, 1: 532, 2: 2392, 3: 3151, 4: 2979} {0: 1, 1: 0, 2: 46, 3: 710, 4: 1781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!