ID: 902931752_902931757

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 902931752 902931757
Species Human (GRCh38) Human (GRCh38)
Location 1:19736354-19736376 1:19736379-19736401
Sequence CCCATGTGGATTGTGGGAGCCAC TTCAAGATGAGATTTGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 190} {0: 7463, 1: 11190, 2: 9643, 3: 7118, 4: 4722}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!