ID: 902950962_902950972

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 902950962 902950972
Species Human (GRCh38) Human (GRCh38)
Location 1:19882572-19882594 1:19882605-19882627
Sequence CCGAGCGCAAGCGGGACGAGCGG GGGCCCTGGCCAAGGAGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43} {0: 1, 1: 0, 2: 5, 3: 43, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!