ID: 902956982_902956991

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 902956982 902956991
Species Human (GRCh38) Human (GRCh38)
Location 1:19932142-19932164 1:19932184-19932206
Sequence CCACGTTGGGCGCCAGAATGTTG CCCGTAGGGTACCCAAAGTCCGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 1, 3: 8, 4: 72} {0: 9, 1: 12, 2: 9, 3: 12, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!