ID: 902959620_902959638

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 902959620 902959638
Species Human (GRCh38) Human (GRCh38)
Location 1:19953857-19953879 1:19953905-19953927
Sequence CCCCTTGCCCTTTGGCTCCTGGT CAGGGGAATCAGATGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!