|
Left Crispr |
Right Crispr |
| Crispr ID |
902964985 |
902964990 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:19994658-19994680
|
1:19994693-19994715
|
| Sequence |
CCTCATCTTTGTGGATTTATCTA |
GAGGCTGATGACTTCTGGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 318, 1: 5680, 2: 2445, 3: 861, 4: 590} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|