ID: 902964985_902964990

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 902964985 902964990
Species Human (GRCh38) Human (GRCh38)
Location 1:19994658-19994680 1:19994693-19994715
Sequence CCTCATCTTTGTGGATTTATCTA GAGGCTGATGACTTCTGGATGGG
Strand - +
Off-target summary {0: 318, 1: 5680, 2: 2445, 3: 861, 4: 590} {0: 1, 1: 6, 2: 89, 3: 241, 4: 549}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!