|
Left Crispr |
Right Crispr |
| Crispr ID |
902973097 |
902973101 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:20069549-20069571
|
1:20069566-20069588
|
| Sequence |
CCTGTGGTCCCAGCTACTGGGAG |
TGGGAGGATCGCTGAAGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 25, 1: 349, 2: 3142, 3: 22363, 4: 146369} |
{0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|